As one of the exceedingly rare members of her species to live beyond age 110, Goldie Michelson had divulged her secrets countless times before dying last year at 113.
"Morning walks and chocolate," the Gloucester, Mass., resident and onetime oldest living American told the steady stream of inquisitors that marked her final years.
Unlike the growing ranks of nonagenarians and centenarians, those who breach a 12th decade, known as supercentenarians, rarely face protracted illness or disability before they die, which many of them have ascribed to personal habits.
"I try to live the truth," said Shelby Harris, who threw out the first pitch of his local minor league baseball team's 2012 season a few months before he died at 111 in Rock Island, Ill. Emma Morano of Verbania, Italy, still cooking her own pasta until a few years before she died in April at 117, prescribed raw eggs -- and no husband.
But even as they indulged the notion that lifestyle makes the difference, each agreed to donate DNA to a private effort to find secrets in supercentenarian genes.
The full genetic sequences of Michelson, Harris and Morano are among some three dozen genomes of North American, Caribbean and European supercentenarians that were made available this month to any researcher who wants to dive in, by a nonprofit called Betterhumans.
If unusual patterns in their 3 billion pairs of A's, C's, G's and T's -- the nucleobases that make up all genomes -- can be shown to have prolonged their lives and protected their health, the logic goes, it is conceivable that a drug or gene therapy could be devised to replicate the effects in the rest of us.
"I hope you find something that does someone some good," said Clarence Matthews, 110, who allowed his blood to be drawn as a final contribution to the database in 2016 at his Indian Wells, Calif., home.
ONE IN 5 MILLION
Studies of garden-variety longevity have yielded few solid clues to healthy aging. Lifestyle and luck, it seems, factor heavily into why people reach their 90s and 100s. To the extent that they have a genetic advantage, it appears to come partly from having inherited fewer than usual DNA variations known to raise the risk of heart disease, Alzheimer's and other afflictions.
That is not enough, some researchers say, to explain why supercentenarians are more uniformly healthy than centenarians in their final months. Rather than having lucked into inheriting DNA variations that are less bad, scientists suggest, supercentenarians might possess genetic code that actively protects them from aging.
But the effort to find that code has been challenged by the difficulty of acquiring their DNA.
The New England Centenarian Study, one of a handful of research groups around the world focusing on supercentenarians, now turns down prospective DNA donors younger than 103: "We tell them they're too young," said Dr. Thomas Perls, the study's director.
The DNA sequences released this month were acquired almost single-handedly by James Clement, 61, the founder of a company advised by Harvard geneticist George Church.
A professed citizen-scientist, Clement collected blood, skin or saliva from supercentenarians in 14 states and seven countries over a six-year period. Many were still gardening, arguing, driving and flirting.
The usefulness of such a small group for a genetic study is unclear, which is one reason Clement's company, now defunct, has turned into a crowdsourcing project.
Complex traits like height and body mass index -- called phenotypes -- typically arise from a combination of hundreds of places in the genome where the DNA alphabet differs between individuals.
Zeroing in on which variations affect which phenotypes requires the statistical power of tens of thousands of DNA samples -- almost certainly a deal-breaker when it comes to supercentenarians, whose verified number, worldwide, hovers at about 150.
On large swathes of the planet, where birth records are sketchy or nonexistent, identifying verified supercentenarians is virtually impossible. In the United States, researchers say, supercentenarians account for about one in 5 million people.
Still, some researchers hope that it will be possible to apply research methods used to uncover the genetic basis for other rare conditions. No one quite knows how many genomes might be necessary for that.
"This is what we call an 'extreme phenotype,'" said Church, who ultimately arranged for the genomes to be sequenced so that Clement could release them through a nonprofit. "The farther out you go on the bell curve, the more likely you are to find something, even with a small sample size."
SHORT-TIMERS
In 2011, the first supercentenarian Clement lined up to visit, Mississippi Winn, died at 113 before Clement could get from his home in San Jose, Calif., to hers in Shreveport. She was believed to be the last person in the nation both of whose parents were African-Americans born into slavery.
Of the 70,000 or so Americans who live to be 100, only some two dozen are typically alive at 110. The chance of dying within the next year is roughly 50 percent. After 113, the odds are closer to 66 percent. The oldest person on record, Jeanne Calment, was 122 when she died in 1997; only one other person is known to have lived beyond age 118.
Clement could extract DNA from post-mortem samples, with permission from the family and assuming he could reach the funeral home in time. Exhumation is also possible, in theory, to obtain samples. But for understandable reasons, he said, families typically backed out when a supercentenarian died.
To improve the odds of getting samples -- and the gender balance, since supercentenarians are nearly all women -- he lowered his target age from 110 to 106.
THERE'S A LIST
Guided by the World's Oldest People email list, whose moderator, Robert D. Young, verifies ages on behalf of Guinness World Records and tracks supercentenarians for the Gerontology Research Group, Clement placed decal dots designating the locations of prospective participants on a map pinned to the wall of his home office.
He created Google alerts for the phrases "109th birthday," "110th birthday" and "111th birthday," and for the obituaries of known supercentenarians.
Unlike so-called blue zones, where centenarians are said to cluster, there is no geographical shortcut for netting supercentenarians. So he called, emailed and sent Facebook friend requests to whatever contacts he could find, wherever he could find them.
A BIRTHDAY INVITATION
The kind of ultrarare mutations that supercentenarians might harbor, Church believed, were not likely to be detected with standard techniques, which scan only the places in the genome where DNA is already known to vary between individuals.
To look for as-yet-uncataloged variations would require sequencing all of each supercentenarian's 6 billion genetic letters, a far more expensive procedure. When he and Clement first discussed the idea in 2010, the cost was about $50,000 per genome.
But the price was falling. And with the support of a handful of wealthy investors, "it just seemed," Clement said, "like something I could do."
But even with the Harvard name as a calling card, some of the families he contacted over the next few years did not respond. A few, Clement knew, had already been approached by laboratories at Stanford and Boston University, which were collecting their own stashes of supercentenarian DNA.
An invitation to the 111th birthday party of James Sisnett in Barbados served as Clement's entree in February 2011. Sisnett died two years later. He had grown his own food until he was 105 and was "still fascinated by seeing a nice-looking backside" when he was in his 110s, his 88-year-old daughter said.
The best time to get DNA from a supercentenarian, Clement found, is midmorning. By lunchtime, they would prefer to be eating. After lunch, they are groggy or napping.
Testing quickly discovered 2,500 differences between the supercentenarian DNA and those of controls. But even with help from graduate students in Church's lab, it was hard with such a small group to know which, if any, mattered.
So over the next few years, Clement, working without a salary, collected samples whenever he could, adding another dozen from the United States.
In spring 2016, a company Church had co-founded, Veritas Genetics, announced that it would sequence human genomes for $1,000 each. Church told Clement that Veritas would sequence the remaining samples, and so he set out to collect a few more.
AMERICA'S OLDEST MAN
Today, most of us expect about 80 years on the planet. Life expectancy was 48 when Clarence Matthews was born in 1906.
In July 2016, I accompanied Clement to Matthews' home in California. I feared he would be lonely.
Matthews asserted without hesitation that he enjoyed life -- his lunchtime smoothie, his family, the kindness of his caregiver, and "having my picture taken." He reminisced fondly about dancing with his second wife, Katherine, who died in 1980.
At 110, he said, he had never been diagnosed with a serious illness. His son recalled that his father had played an 18-hole golf game, 1 under par, on his 99th birthday. Having built a successful real estate business, he provided financial support to his last surviving sibling, a sister who was 105.
At the time the oldest man in America, Matthews sometimes strained to hear, but his sense of humor showed. If a long life was what we wanted, he advised, "keep breathing."
He died this summer. His DNA was sequenced a few weeks later, and in October, Clement uploaded it to the database. Like all normal human genome sequences, the beginning of his first chromosome reads like this:
TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT
Whether the rest contains the secret to a long, healthy life remains to be seen.
ActiveStyle on 11/20/2017